Mature sequence eca-miR-431

Accession numberMIMAT0013156
IDeca-miR-431
Stem-Loop eca-mir-431
Sequence
ugucuugcaggccgucaugcagg
Get sequence
Deep sequencing44 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).