Mature sequence eca-miR-433

Accession numberMIMAT0013158
IDeca-miR-433
Stem-Loop eca-mir-433
Sequence
aucaugaugggcuccucggugu
Get sequence
Deep sequencing88 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).