Mature sequence eca-miR-514

Accession numberMIMAT0013234
IDeca-miR-514
Stem-Loop eca-mir-514
Sequence
auugacaccucugugagugga
Get sequence
Deep sequencing3994 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).