Mature sequence bmo-miR-2761-5p

Accession numberMIMAT0013634
IDbmo-miR-2761-5p
Previous IDsbmo-miR-2761*
Stem-Loop bmo-mir-2761
Sequence
caucgagacgguuccauaca
Get sequence
Deep sequencing18 reads, 2 experiments

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).