Mature sequence bmo-miR-1b-5p

Accession numberMIMAT0013787
IDbmo-miR-1b-5p
Previous IDsbmo-miR-1-as*;bmo-miR-1b*
Stem-Loop bmo-mir-1b
Sequence
ccauacuucuuuacauuccaua
Get sequence
Deep sequencing7 reads, 3 experiments

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).