Mature sequence bmo-miR-1b-3p

Accession numberMIMAT0013788
IDbmo-miR-1b-3p
Previous IDsbmo-miR-1-as;bmo-miR-1
Stem-Loop bmo-mir-1b
Sequence
ugggaaguaaggaagcacggaa
Get sequence
Deep sequencing113 reads, 3 experiments
Database links
QuickGO function

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).