Mature sequence osa-miR396d

Accession numberMIMAT0013835
IDosa-miR396d
Stem-Loop osa-MIR396d
Sequence
uccacaggcuuucuugaacgg
Get sequence
Deep sequencing1577 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).