Mature sequence zma-miR159j-3p

Accession numberMIMAT0013979
IDzma-miR159j-3p
Previous IDszma-miR159j
Stem-Loop zma-MIR159j
Sequence
uuuggauugaagggagcucug
Get sequence
Deep sequencing9378 reads, 190 experiments
Database links
QuickGO function

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).