Mature sequence zma-miR164f-5p

Accession numberMIMAT0013983
IDzma-miR164f-5p
Previous IDszma-miR164f
Stem-Loop zma-MIR164f
Sequence
uggagaagcagggcacgugcu
Get sequence
Deep sequencing3844 reads, 12 experiments
Database links
QuickGO function

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).