Mature sequence zma-miR395e-3p

Accession numberMIMAT0014002
IDzma-miR395e-3p
Previous IDszma-miR395e
Stem-Loop zma-MIR395e
Sequence
gugaaguguuugggggaacuc
Get sequence
Deep sequencing33 reads, 13 experiments

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).