Mature sequence aae-bantam-3p

Accession numberMIMAT0014219
IDaae-bantam-3p
Stem-Loop aae-bantam
Sequence
ugagaucauuuugaaagcugau
Get sequence
Deep sequencing48412 reads, 2 experiments

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).