Mature sequence aae-miR-2943

Accession numberMIMAT0014301
IDaae-miR-2943
Stem-Loop aae-mir-2943-1 aae-mir-2943-2
Sequence
uuaaguaggcacuugcaggcaaa
Get sequence
Deep sequencing154 reads, 2 experiments

References

1