Mature sequence aae-miR-92b-3p

Accession numberMIMAT0014322
IDaae-miR-92b-3p
Previous IDsaae-miR-92b
Stem-Loop aae-mir-92b
Sequence
aauugcacuugucccggccugc
Get sequence
Deep sequencing17903 reads, 2 experiments

References

1