Mature sequence aae-miR-2946

Accession numberMIMAT0014325
IDaae-miR-2946
Stem-Loop aae-mir-2946
Sequence
uaguacggaaaagauaugggga
Get sequence
Deep sequencing38 reads, 2 experiments

References

1