Mature sequence api-miR-3052

Accession numberMIMAT0014793
IDapi-miR-3052
Stem-Loop api-mir-3052
Sequence
ugcauucuuugagcuuagcaugauggcu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).