Mature sequence mmu-miR-3070-5p

Accession numberMIMAT0014846
IDmmu-miR-3070-5p
Previous IDsmmu-miR-3070a-5p
Stem-Loop mmu-mir-3070-1 mmu-mir-3070-2
Sequence
agccccugaccuugaaccuggga
Get sequence
Deep sequencing151 reads, 13 experiments

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).