Mature sequence mmu-miR-3071-5p

Accession numberMIMAT0014850
IDmmu-miR-3071-5p
Previous IDsmmu-miR-3071
Stem-Loop mmu-mir-3071
Sequence
acucauuugagacgaugaugga
Get sequence
Deep sequencing86 reads, 10 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).