Mature sequence oar-miR-133

Accession numberMIMAT0014972
IDoar-miR-133
Stem-Loop oar-mir-133
Sequence
uugguccccuucaaccagcugu
Get sequence
Deep sequencing3936 reads, 13 experiments

References

1
PMID:20140706 "Characterization of microRNAs from sheep (Ovis aries) using computational and experimental analyses" Sheng X, Song X, Yu Y, Niu L, Li S, Li H, Wei C, Liu T, Zhang L, Du L Mol Biol Rep. 38:3161-3171(2011).