Mature sequence hsa-miR-3174

Accession numberMIMAT0015051
IDhsa-miR-3174
Stem-Loop hsa-mir-3174
Sequence
uagugaguuagagaugcagagcc
Get sequence
Deep sequencing452 reads, 72 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).