Mature sequence hsa-miR-3191-3p

Accession numberMIMAT0015075
IDhsa-miR-3191-3p
Previous IDshsa-miR-3191
Stem-Loop hsa-mir-3191
Sequence
uggggacguagcuggccagacag
Get sequence
Deep sequencing73 reads, 27 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).