Mature sequence zma-miR156d-3p

Accession numberMIMAT0015124
IDzma-miR156d-3p
Previous IDszma-miR156d*
Stem-Loop zma-MIR156d
Sequence
gcucacuucucuuucugucagc
Get sequence
Deep sequencing1396 reads, 165 experiments
Database links
QuickGO function

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).