Mature sequence osa-miR396e-3p

Accession numberMIMAT0015159
IDosa-miR396e-3p
Stem-Loop osa-MIR396e
Sequence
augguucaagaaagcccauggaaa
Get sequence
Deep sequencing45 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:15805478 "Cloning and characterization of microRNAs from rice" Sunkar R, Girke T, Jain PK, Zhu JK Plant Cell. 17:1397-1411(2005).
2
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).