Mature sequence bmo-miR-79-5p

Accession numberMIMAT0015275
IDbmo-miR-79-5p
Previous IDsbmo-miR-79*
Stem-Loop bmo-mir-79
Sequence
cuuuggcgauuuagcuccguga
Get sequence
Deep sequencing7 reads, 2 experiments

References

1
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
2
3
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).