Mature sequence zma-miR164g-3p

Accession numberMIMAT0015319
IDzma-miR164g-3p
Previous IDszma-miR164g*
Stem-Loop zma-MIR164g
Sequence
cacgugcuccccuucuccacc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).