Mature sequence cin-miR-4026-3p

Accession numberMIMAT0016543
IDcin-miR-4026-3p
Stem-Loop cin-mir-4026
Sequence
ucuaugacgucauuacuacg
Get sequence
Deep sequencing reads, experiments

References

1