Mature sequence cin-miR-4039-5p

Accession numberMIMAT0016567
IDcin-miR-4039-5p
Stem-Loop cin-mir-4039
Sequence
uauaugaagauguaagcuau
Get sequence
Deep sequencing12993 reads, 2 experiments

References

1