Mature sequence cin-miR-4039-3p

Accession numberMIMAT0016568
IDcin-miR-4039-3p
Stem-Loop cin-mir-4039
Sequence
auaguuuguuucuuuguauu
Get sequence
Deep sequencing1 reads, 1 experiments

References

1