Mature sequence cin-miR-4052-5p

Accession numberMIMAT0016593
IDcin-miR-4052-5p
Stem-Loop cin-mir-4052
Sequence
caggcuugcauuucaaguaa
Get sequence
Deep sequencing5 reads, 1 experiments

References

1