Mature sequence cin-miR-4052-3p

Accession numberMIMAT0016594
IDcin-miR-4052-3p
Stem-Loop cin-mir-4052
Sequence
ucacuugaaacccaggaccu
Get sequence
Deep sequencing178 reads, 2 experiments

References

1