Mature sequence cin-miR-4072-5p

Accession numberMIMAT0016632
IDcin-miR-4072-5p
Stem-Loop cin-mir-4072
Sequence
uuuguuuuaaggcuucauuuucu
Get sequence
Deep sequencing15 reads, 2 experiments

References

1