Mature sequence cin-miR-4073-5p

Accession numberMIMAT0016634
IDcin-miR-4073-5p
Stem-Loop cin-mir-4073
Sequence
acgacaaguaggguccuuuu
Get sequence
Deep sequencing62 reads, 2 experiments

References

1