Mature sequence cin-miR-4073-3p

Accession numberMIMAT0016635
IDcin-miR-4073-3p
Stem-Loop cin-mir-4073
Sequence
caggauguucgacuuguugu
Get sequence
Deep sequencing22 reads, 1 experiments

References

1