Mature sequence cin-miR-4086-3p

Accession numberMIMAT0016661
IDcin-miR-4086-3p
Stem-Loop cin-mir-4086
Sequence
cauuuugauggcuaccuccc
Get sequence
Deep sequencing reads, experiments

References

1