Mature sequence cin-miR-4165-3p

Accession numberMIMAT0016773
IDcin-miR-4165-3p
Stem-Loop cin-mir-4165
Sequence
ugagugggcaaaaugggaca
Get sequence
Deep sequencing reads, experiments

References

1