Mature sequence cin-miR-4181-5p

Accession numberMIMAT0016794
IDcin-miR-4181-5p
Stem-Loop cin-mir-4181
Sequence
auugugucagccugucguucu
Get sequence
Deep sequencing1 reads, 1 experiments

References

1