Mature mmu-miR-149-3p
| Accession | MIMAT0016990 |
| Description | mmu-miR-149-3p mature miRNA |
| Hairpins | |
| Sequence | GAGGGAGGGACGGGGGCGGUGC |
| Evidence |
experimental
Illumina [4] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29029439 | has_input UniProtKB:P42227 |
| involved_in | GO:0050728 negative regulation of inflammatory response |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:29029439 | occurs_in UBERON:0002107 |
| involved_in | GO:0071222 cellular response to lipopolysaccharide |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29029439 | occurs_in UBERON:0002107 |
| involved_in | GO:1904893 negative regulation of receptor signaling pathway via STAT |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:29029439 | occurs_in UBERON:0002107 |
