Accession | MIMAT0017056 |
Description | mmu-miR-223-5p mature miRNA |
Hairpins | |
Sequence | CGUGUAUUUGACAAGCUGAGUUG |
Evidence |
experimental
Illumina [5] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27502281 | has_input UniProtKB:Q9EPU5 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27502281 | has_input UniProtKB:Q9EPU5 |
involved_in | GO:0050728 negative regulation of inflammatory response |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:27502281 | occurs_in UBERON:0002349 |
involved_in | GO:0060546 negative regulation of necroptotic process |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:27502281 | occurs_in UBERON:0002349 |