Mature sequence rno-miR-483-5p

Accession numberMIMAT0017201
IDrno-miR-483-5p
Previous IDsrno-miR-483*
Stem-Loop rno-mir-483
Sequence
aagacgggagaagagaagggag
Get sequence
Deep sequencing1140 reads, 170 experiments
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).