Mature sequence aly-miR156g-5p

Accession numberMIMAT0017409
IDaly-miR156g-5p
Previous IDsaly-miR156g
Stem-Loop aly-MIR156g
Sequence
cgacagaagagagugagcac
Get sequence
Deep sequencing156 reads, 1 experiments

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).