Mature sequence aly-miR167d-5p

Accession numberMIMAT0017479
IDaly-miR167d-5p
Previous IDsaly-miR167d
Stem-Loop aly-MIR167d
Sequence
ugaagcugccagcaugaucugg
Get sequence
Deep sequencing3689 reads, 1 experiments
Database links
QuickGO function

References

1
2
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).