Mature sequence aly-miR169g-3p

Accession numberMIMAT0017498
IDaly-miR169g-3p
Previous IDsaly-miR169g*
Stem-Loop aly-MIR169g
Sequence
gcaaguugaccuuggcucugu
Get sequence
Deep sequencing17 reads, 1 experiments
Database links
QuickGO function

References

1
2
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).