Mature sequence aly-miR396a-3p

Accession numberMIMAT0017558
IDaly-miR396a-3p
Previous IDsaly-miR396a*
Stem-Loop aly-MIR396a
Sequence
guucaauaaagcugugggaag
Get sequence
Deep sequencing724 reads, 1 experiments
Database links
QuickGO function

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).