Mature sequence aly-miR847-3p

Accession numberMIMAT0017638
IDaly-miR847-3p
Previous IDsaly-miR847
Stem-Loop aly-MIR847
Sequence
ucacuccucuucuucaugaug
Get sequence
Deep sequencing1 reads, 1 experiments

References

1
2
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).