Mature sequence aly-miR856-5p

Accession numberMIMAT0017641
IDaly-miR856-5p
Previous IDsaly-miR856
Stem-Loop aly-MIR856
Sequence
uaauuccaccaauaacuucagc
Get sequence
Deep sequencing reads, experiments

References

1
2
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).