Mature sequence aly-miR3441-3p.1

Accession numberMIMAT0017715
IDaly-miR3441-3p.1
Previous IDsaly-miR3441.1*
Stem-Loop aly-MIR3441
Sequence
cccucaaugauguuuugaagc
Get sequence
Deep sequencing13 reads, 1 experiments

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).