Mature sequence rno-miR-344b-5p

Accession numberMIMAT0017811
IDrno-miR-344b-5p
Stem-Loop rno-mir-344b-2 rno-mir-344b-1 rno-mir-344b-3
Sequence
agucaggcugcugguuauauuc
Get sequence
Deep sequencing4129 reads, 84 experiments

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).