Mature sequence rno-miR-344b-3p

Accession numberMIMAT0017812
IDrno-miR-344b-3p
Previous IDsrno-miR-344b-2-3p
Stem-Loop rno-mir-344b-2 rno-mir-344b-3
Sequence
gguauaaccaaagcccgacugu
Get sequence
Deep sequencing31594 reads, 158 experiments

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).