Mature sequence rno-miR-466d

Accession numberMIMAT0017824
IDrno-miR-466d
Stem-Loop rno-mir-466d
Sequence
auguguguguauguccuuuugu
Get sequence
Deep sequencing48 reads, 41 experiments
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).