Mature sequence aly-miR399j

Accession numberMIMAT0017906
IDaly-miR399j
Stem-Loop aly-MIR399j
Sequence
uugccaaaggagauuugcccg
Get sequence
Deep sequencing5 reads, 1 experiments

References

1