Mature sequence aly-miR4221

Accession numberMIMAT0017909
IDaly-miR4221
Stem-Loop aly-MIR4221
Sequence
aagaguucaaaaguagugaaga
Get sequence
Deep sequencing10 reads, 1 experiments

References

1